The first complete genome sequence and pathogenicity characterization of fowl adenovirus 11 from chickens with inclusion body hepatitis in Pakistan.

Inclusion body hepatitis (IBH), hydropericardium syndrome, and gizzard erosion associated with fowl adenovirus (FAdV) infections are reported globally and resulted in significant poultry industry economic losses. In 2018, severe IBH appeared in Pakistan in a 17-week-old layer flock. Subsequently, a FAdV-11 strain (designated as PKFAd18) was isolated from liver samples and identified based on phylogenetic analyses of the serotype-specific L1 region of the capsid hexon gene.

There is no complete genome sequence of the Pakistani FAdV-11. This study successfully sequenced the complete genome of PKFAd18. The full genome of PKFAd18 contains 43 840 base pairs (bp) with a G + C content of 53.9 %, which is comparable to other FAdV serotypes.

Similar to other FAdV-11 strains, PKFAd18 has only one fiber, while FAdV-1 and FAdV-4 have two fibers. Notably, PKFAd18 showed unique characteristics compared to other FAdV-11 strains. A natural large genomic deletion (1215 bp) appeared in tandem repeat region two, relative to the ON-NP2 strain.

Cyanine 5 bissuccinimidyl ester [equivalent to Cy5® bisNHS ester]

157 1 mg
EUR 219.00
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

HLA-DOA antibody

70R-36263 100 ug
EUR 327.00
Description: Rabbit polyclonal HLA-DOA antibody

HLA- DOA Antibody

ABD4118 100 ug
EUR 438.00

HLA-DOA Antibody

34735-100ul 100ul
EUR 252.00

HLA-DOA Antibody

34735-50ul 50ul
EUR 187.00

HLA-DOA siRNA

20-abx919559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HLA-DOA Antibody

1-CSB-PA002934
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HLA-DOA. Recognizes HLA-DOA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

HLA-DOA Antibody

CSB-PA113671-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HLA-DOA. Recognizes HLA-DOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HLA-DOA Antibody

CSB-PA113671-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HLA-DOA. Recognizes HLA-DOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HLA-DOA Antibody

1-CSB-PA356784ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HLA-DOA. Recognizes HLA-DOA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-HLA-DOA

YF-PA12334 50 ul
EUR 363.00
Description: Mouse polyclonal to HLA-DOA

anti-HLA-DOA

YF-PA12335 50 ug
EUR 363.00
Description: Mouse polyclonal to HLA-DOA

anti-HLA-DOA

YF-PA12336 50 ul
EUR 363.00
Description: Mouse polyclonal to HLA-DOA

anti-HLA-DOA

YF-PA12337 50 ug
EUR 363.00
Description: Mouse polyclonal to HLA-DOA

anti-HLA-DOA

YF-PA12338 100 ul
EUR 403.00
Description: Rabbit polyclonal to HLA-DOA

anti-HLA-DOA

YF-PA12339 100 ug
EUR 403.00
Description: Rabbit polyclonal to HLA-DOA

HLA-DOA Antibody

DF4118 200ul
EUR 304.00
Description: HLA-DOA Antibody detects endogenous levels of total HLA-DOA.

HLA-DOA Conjugated Antibody

C34735 100ul
EUR 397.00

HLA-DOA Blocking Peptide

20-abx061300
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HLA-DOA cloning plasmid

CSB-CL356784HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atggccctcagagcagggctggtcctggggttccacaccctgatgaccctcctgagcccgcaggaggcaggggccaccaaggctgaccacatgggctcctacggacccgccttctaccagtcttacggcgcctcgggccagttcacccatgaatttgatgaggaacagctgttctc
  • Show more
Description: A cloning plasmid for the HLA-DOA gene.

HLA-DOA Polyclonal Antibody

E-AB-31696-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: HLA-DOA belongs to the HLA class II alpha chain paralogues. HLA-DOA forms a heterodimer with
  • Show more
Description: Rabbit antibody against Human HLA-DOA for WB,IHC-p,ELISA applications.

HLA-DOA Polyclonal Antibody

E-AB-31696-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: HLA-DOA belongs to the HLA class II alpha chain paralogues. HLA-DOA forms a heterodimer with
  • Show more
Description: Rabbit antibody against Human HLA-DOA for WB,IHC-p,ELISA applications.

HLA-DOA Polyclonal Antibody

E-AB-31696-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: HLA-DOA belongs to the HLA class II alpha chain paralogues. HLA-DOA forms a heterodimer with
  • Show more
Description: Rabbit antibody against Human HLA-DOA for WB,IHC-p,ELISA applications.

pCMV-SPORT6-HLA-DOA

PVT13798 2 ug
EUR 391.00

HLA-DOA Rabbit pAb

A15277-100ul 100 ul
EUR 308.00

HLA-DOA Rabbit pAb

A15277-200ul 200 ul
EUR 459.00

HLA-DOA Rabbit pAb

A15277-20ul 20 ul
EUR 183.00

HLA-DOA Rabbit pAb

A15277-50ul 50 ul
EUR 223.00

HLA-DOA Rabbit pAb

A6923-100ul 100 ul
EUR 308.00

HLA-DOA Rabbit pAb

A6923-200ul 200 ul
EUR 459.00

HLA-DOA Rabbit pAb

A6923-20ul 20 ul
EUR 183.00

HLA-DOA Rabbit pAb

A6923-50ul 50 ul
EUR 223.00

HLA-DOA Blocking Peptide

DF4118-BP 1mg
EUR 195.00

NF 157

B7060-10 10 mg
EUR 389.00

NF 157

B7060-50 50 mg
EUR 1476.00

NT-157

B2087-1 1 mg
EUR 125.00
  • Synonims: (E)-3-(3-bromo-4,5-dihydroxyphenyl)-N-(3,4,5-trihydroxybenzyl)prop-2-enethioamideProtect from air and light
Description: NT-157 is a small molecule tyrphostin that acts as a potent and selective inhibitor of IRS-1/2. NT157 treatment results in dose-dependent inhibition of IGF1R activation, suppression of IRS protein expression, inhibition of IGF1-induced AKT activation, but increases ERK activation in NT157-treated cells in vitro.

NT-157

B2087-5 5 mg
EUR 348.00
  • Synonims: (E)-3-(3-bromo-4,5-dihydroxyphenyl)-N-(3,4,5-trihydroxybenzyl)prop-2-enethioamideProtect from air and light
Description: NT-157 is a small molecule tyrphostin that acts as a potent and selective inhibitor of IRS-1/2. NT157 treatment results in dose-dependent inhibition of IGF1R activation, suppression of IRS protein expression, inhibition of IGF1-induced AKT activation, but increases ERK activation in NT157-treated cells in vitro.

CX-157

HY-100178 1mg
EUR 1127.00

HLA-DOA protein (His tag)

80R-2891 100 ug
EUR 327.00
Description: Purified recombinant HLA-DOA protein (His tag)

Human HLA-DOA shRNA Plasmid

20-abx952124
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HLA-DOA ELISA KIT

ELI-32014h 96 Tests
EUR 824.00

RT1-DOa Recombinant Protein (Rat)

RP227123 100 ug Ask for price

HLA-DOA Recombinant Protein (Human)

RP014857 100 ug Ask for price

Rho A L63 (Constitutively Active) Recombinant Adenovirus

ADV-157 50 ?L
EUR 891.00
Description: Premade recombinant adenovirus containing the L63 constitutively active mutant of the RhoA gene

SIDEARM FITTING, DUAL, 8 L, 1/4 TUBING

4519-157 1/pk
EUR 362.00
Description: Bioprocess Vessels; Spinner Accessories

Recombinant Human C1QTNF2 Protein-6His-ABP tag

CTP-157 100ug Ask for price
Description: A 25 kDa recombinant human C1QTNF2 protein Antigen with a N-terminal His6-ABP tag expressed in E. Coli.

RT1-DOa ORF Vector (Rat) (pORF)

ORF075709 1.0 ug DNA
EUR 506.00

HLA-DOA ORF Vector (Human) (pORF)

ORF004953 1.0 ug DNA
EUR 95.00

VASP (Ab-157) Antibody

21207-100ul 100ul
EUR 252.00

VASP (Ab-157) Antibody

21207-50ul 50ul
EUR 187.00

E. coli O 157

abx291002-100mg 100 mg
EUR 620.00
  • Shipped within 2 months.

VASP (Ab-157) Antibody

CSB-PA158569-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against VASP (Ab-157). Recognizes VASP (Ab-157) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

VASP (Ab-157) Antibody

CSB-PA158569-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against VASP (Ab-157). Recognizes VASP (Ab-157) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

anti-VASP (Ab-157)

LF-PA20516 100 ul
EUR 334.00
Description: Rabbit polyclonal to VASP

MDA-MB-157 cells

C0006020 One Frozen vial
EUR 455.00

JH-VIII-157-02

HY-112140 10mM/1mL
EUR 744.00

Chemerin-9 (149-157)

HY-P1844 10mg
EUR 567.00

FGF basic (157 aa)

PR15003 25 ug
EUR 370.00

HLA-DOA sgRNA CRISPR Lentivector set (Human)

K0963901 3 x 1.0 ug
EUR 339.00

RT1-DOa sgRNA CRISPR Lentivector set (Rat)

K6892601 3 x 1.0 ug
EUR 339.00

[Ile161]MAGE - A2 (157 - 166)

5-00208 4 x 5mg Ask for price

p60 v-src (137-157)

5-01682 4 x 1mg Ask for price

Anti-VASP (Ab-157) Antibody

A00303 100ul
EUR 397.00
Description: Rabbit Polyclonal VASP (Ab-157) Antibody. Validated in IF, WB and tested in Human, Rat.

E. Coli O 157 Protein

abx061475-01ml 0.1 ml
EUR 551.00
  • Shipped within 5-10 working days.

VASP (Ab-157) Conjugated Antibody

C21207 100ul
EUR 397.00

p60 v-src (137-157)

H-8535.0500 0.5mg
EUR 212.00
Description: Sum Formula: C111H168N30O35; CAS# [131023-24-0]

p60 v-src (137-157)

H-8535.1000 1.0mg
EUR 334.00
Description: Sum Formula: C111H168N30O35; CAS# [131023-24-0]

Chemerin-9 (149-157) (TFA)

HY-P1844A 1mg
EUR 187.00

Recombinant ASFV Mal-157 Protein

VAng-2286Lsx-inquire inquire Ask for price
Description: African swine fever virus (isolate Tick/Malawi/Lil 20-1/1983) Protein MGF 505-11L (Mal-157), partial, recombinant protein from E. coli. (Uniprot ID: Q65259)

HLA-DOA sgRNA CRISPR Lentivector (Human) (Target 1)

K0963902 1.0 ug DNA
EUR 154.00

HLA-DOA sgRNA CRISPR Lentivector (Human) (Target 2)

K0963903 1.0 ug DNA
EUR 154.00

HLA-DOA sgRNA CRISPR Lentivector (Human) (Target 3)

K0963904 1.0 ug DNA
EUR 154.00

RT1-DOa sgRNA CRISPR Lentivector (Rat) (Target 1)

K6892602 1.0 ug DNA
EUR 154.00

RT1-DOa sgRNA CRISPR Lentivector (Rat) (Target 2)

K6892603 1.0 ug DNA
EUR 154.00

RT1-DOa sgRNA CRISPR Lentivector (Rat) (Target 3)

K6892604 1.0 ug DNA
EUR 154.00

HLA-DOA Protein Vector (Human) (pPB-C-His)

PV019809 500 ng
EUR 329.00

HLA-DOA Protein Vector (Human) (pPB-N-His)

PV019810 500 ng
EUR 329.00

HLA-DOA Protein Vector (Human) (pPM-C-HA)

PV019811 500 ng
EUR 329.00

HLA-DOA Protein Vector (Human) (pPM-C-His)

PV019812 500 ng
EUR 329.00

HLA-DOA 3'UTR Luciferase Stable Cell Line

TU009901 1.0 ml
EUR 1521.00

RT1-DOa Protein Vector (Rat) (pPB-C-His)

PV302834 500 ng
EUR 603.00

RT1-DOa Protein Vector (Rat) (pPB-N-His)

PV302835 500 ng
EUR 603.00

RT1-DOa Protein Vector (Rat) (pPM-C-HA)

PV302836 500 ng
EUR 603.00

RT1-DOa Protein Vector (Rat) (pPM-C-His)

PV302837 500 ng
EUR 603.00

HLA-DOA 3'UTR GFP Stable Cell Line

TU059901 1.0 ml
EUR 1521.00

RT1-DOa 3'UTR Luciferase Stable Cell Line

TU219793 1.0 ml Ask for price

RT1-DOa 3'UTR GFP Stable Cell Line

TU269793 1.0 ml Ask for price

Recombinant Human HLA-DOA Protein, His, E.coli-1mg

QP12274-1mg 1mg
EUR 2757.00

Recombinant Human HLA-DOA Protein, His, E.coli-20ug

QP12274-20ug 20ug
EUR 201.00

Recombinant Human HLA-DOA Protein, His, E.coli-5ug

QP12274-5ug 5ug
EUR 155.00

Zinc Finger Protein 157 (Zfp157) Antibody

abx432152-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

[Ile161]MAGE A2 (157-166) Peptide

20-abx266206
  • EUR 439.00
  • EUR 718.00
  • EUR 328.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

FGF basic (157 aa), carrier-free

PR15003CF 25 ug
EUR 370.00

RT1-DOa Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV650173 1.0 ug DNA
EUR 514.00

RT1-DOa Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV650177 1.0 ug DNA
EUR 514.00

RT1-DOa Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV650178 1.0 ug DNA
EUR 514.00

Advanced Glycation End Products (Clone 9), DNA Aptamer, Biotinylated

AD-157-B Custom Ask for price

Advanced Glycation End Products (Clone 9), DNA Aptamer, FITC labeled

AD-157-F Custom Ask for price

Advanced Glycation End Products (Clone 9), DNA Aptamer, unlabeled

AD-157-U Custom Ask for price

perfluorophenyl 1-(cyclooct-2-ynyloxy)-2-oxo-6,9,12-trioxa-3-azapentadecan-15-oate

ADC-L-157 unit Ask for price

Anti-Hu CD114 PE

1P-157-T025 25 tests
EUR 140.00

Anti-Hu CD114 PE

1P-157-T100 100 tests
EUR 240.00

Anti-Hu CD114 Purified

11-157-C025 0.025 mg
EUR 99.00

Anti-Hu CD114 Purified

11-157-C100 0.1 mg
EUR 158.00

Anti-FOLH1-VC-MMAF ADC

ADC-W-157 1mg Ask for price
Description: This ADC product is comprised of an anti-FOLH1 monoclonal antibody conjugated via a VC linker to MMAF

G-Protein Coupled Receptor 157 (GPR157) Antibody

abx029770-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 157 (GPR157) Antibody

abx029770-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Human G-protein coupled receptor 157 (GPR157)

1-CSB-CF713185HU
  • EUR 1305.00
  • EUR 579.00
  • EUR 836.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 39.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human G-protein coupled receptor 157(GPR157) expressed in in vitro E.coli expression system

G Protein-Coupled Receptor 157 (GPR157) Antibody

20-abx324354
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 157 (GPR157) Antibody

20-abx015310
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Recombinant Salmonella yjjB Protein (aa 1-157)

VAng-Wyb0764-inquire inquire Ask for price
Description: Salmonella UPF0442 protein yjjB UPF0442 protein yjjB, recombinant protein.

Recombinant Salmonella smg Protein (aa 1-157)

VAng-Wyb1205-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Salmonella paratyphi A (strain AKU_12601) Protein smg, recombinant protein.

Recombinant Salmonella smg Protein (aa 1-157)

VAng-Wyb1205-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Salmonella paratyphi A (strain AKU_12601) Protein smg, recombinant protein.

Recombinant Salmonella smg Protein (aa 1-157)

VAng-Wyb1205-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Salmonella paratyphi A (strain AKU_12601) Protein smg, recombinant protein.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

20-abx006404
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

20-abx133718
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

20-abx324661
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

20-abx320822
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

abx145588-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

20-abx014527
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

abx034678-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

abx034678-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Major Histocompatibility Complex, Class II, DO Alpha (HLA-DOA) Antibody

abx330990-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

HLA-DOA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0963905 3 x 1.0 ug
EUR 376.00

RT1-DOa sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6892605 3 x 1.0 ug
EUR 376.00

Human Zinc finger protein 157, ZNF157 ELISA KIT

ELI-14780h 96 Tests
EUR 824.00

Human RING finger protein 157, RNF157 ELISA KIT

ELI-44960h 96 Tests
EUR 824.00

Mouse RING finger protein 157, Rnf157 ELISA KIT

ELI-52801m 96 Tests
EUR 865.00

Recombinant Clostridium Novyi ispF Protein (aa 1-157)

VAng-Lsx9999-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Clostridium Novyi (strain NT) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, recombinant protein.

Recombinant Clostridium Novyi ispF Protein (aa 1-157)

VAng-Lsx9999-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Clostridium Novyi (strain NT) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, recombinant protein.

Recombinant Clostridium Novyi ispF Protein (aa 1-157)

VAng-Lsx9999-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Clostridium Novyi (strain NT) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, recombinant protein.

Recombinant Campylobacter Jejuni fur Protein (aa 1-157)

VAng-Ly2636-1mgEcoli 1 mg (E. coli)
EUR 3198.00
Description: Campylobacter Jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828) ferric uptake regulation protein (fur), recombination protein.

Recombinant Campylobacter Jejuni fur Protein (aa 1-157)

VAng-Ly2636-500gEcoli 500 µg (E. coli)
EUR 2291.00
Description: Campylobacter Jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828) ferric uptake regulation protein (fur), recombination protein.

Recombinant Campylobacter Jejuni fur Protein (aa 1-157)

VAng-Ly2636-50gEcoli 50 µg (E. coli)
EUR 1576.00
Description: Campylobacter Jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828) ferric uptake regulation protein (fur), recombination protein.

Recombinant Caenorhabditis Elegans F54F2.7 Protein (aa 1-157)

VAng-Ly3405-1mgEcoli 1 mg (E. coli)
EUR 3198.00
Description: Caenorhabditis Elegans uncharacterized protein F54F2.7 (F54F2.7), recombination protein.

Recombinant Caenorhabditis Elegans F54F2.7 Protein (aa 1-157)

VAng-Ly3405-500gEcoli 500 µg (E. coli)
EUR 2291.00
Description: Caenorhabditis Elegans uncharacterized protein F54F2.7 (F54F2.7), recombination protein.

Recombinant Caenorhabditis Elegans F54F2.7 Protein (aa 1-157)

VAng-Ly3405-50gEcoli 50 µg (E. coli)
EUR 1576.00
Description: Caenorhabditis Elegans uncharacterized protein F54F2.7 (F54F2.7), recombination protein.

Polyclonal Goat Anti-GOT1 (aa 157-167) Antibody

AMM04995G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GOT1 (aa 157-167) . This antibody is tested and proven to work in the following applications:

Recombinant Haemophilus Influenzae HI0489 Protein (aa 1-157)

VAng-Lsx03343-inquire inquire Ask for price
Description: Haemophilus Influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) Uncharacterized protein HI_0489, recombinant protein.

Recombinant Aeromonas Salmonicida smg Protein (aa 1-157)

VAng-Lsx1111-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Aeromonas Salmonicida Protein smg homolog (aa 1-157), recombinant protein.

Recombinant Aeromonas Salmonicida smg Protein (aa 1-157)

VAng-Lsx1111-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Aeromonas Salmonicida Protein smg homolog (aa 1-157), recombinant protein.

Recombinant Aeromonas Salmonicida smg Protein (aa 1-157)

VAng-Lsx1111-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Aeromonas Salmonicida Protein smg homolog (aa 1-157), recombinant protein.

Recombinant Clostridium Botulinum CLB_1397 Protein (aa 1-157)

VAng-Lsx8027-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Clostridium Botulinum (strain ATCC 19397 / Type A) UPF0251 protein CLB_1397, recombinant protein.

Recombinant Clostridium Botulinum CLB_1397 Protein (aa 1-157)

VAng-Lsx8027-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Clostridium Botulinum (strain ATCC 19397 / Type A) UPF0251 protein CLB_1397, recombinant protein.

Recombinant Clostridium Botulinum CLB_1397 Protein (aa 1-157)

VAng-Lsx8027-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Clostridium Botulinum (strain ATCC 19397 / Type A) UPF0251 protein CLB_1397, recombinant protein.

Recombinant Clostridium Botulinum CLD_3165 Protein (aa 1-157)

VAng-Lsx8056-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Clostridium Botulinum (strain Okra / Type B1) UPF0251 protein CLD_3165, recombinant protein.

Recombinant Clostridium Botulinum CLD_3165 Protein (aa 1-157)

VAng-Lsx8056-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Clostridium Botulinum (strain Okra / Type B1) UPF0251 protein CLD_3165, recombinant protein.

Recombinant Clostridium Botulinum CLD_3165 Protein (aa 1-157)

VAng-Lsx8056-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Clostridium Botulinum (strain Okra / Type B1) UPF0251 protein CLD_3165, recombinant protein.

Recombinant Clostridium Botulinum CLJ_B1488 Protein (aa 1-157)

VAng-Lsx8080-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Clostridium Botulinum (strain 657 / Type Ba4) UPF0251 protein CLJ_B1488, recombinant protein.

Recombinant Clostridium Botulinum CLJ_B1488 Protein (aa 1-157)

VAng-Lsx8080-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Clostridium Botulinum (strain 657 / Type Ba4) UPF0251 protein CLJ_B1488, recombinant protein.

Recombinant Clostridium Botulinum CLJ_B1488 Protein (aa 1-157)

VAng-Lsx8080-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Clostridium Botulinum (strain 657 / Type Ba4) UPF0251 protein CLJ_B1488, recombinant protein.

Recombinant Clostridium Botulinum CLM_1546 Protein (aa 1-157)

VAng-Lsx8116-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Clostridium Botulinum (strain Kyoto / Type A2) UPF0251 protein CLM_1546, recombinant protein.

Recombinant Clostridium Botulinum CLM_1546 Protein (aa 1-157)

VAng-Lsx8116-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Clostridium Botulinum (strain Kyoto / Type A2) UPF0251 protein CLM_1546, recombinant protein.

Recombinant Clostridium Botulinum CLM_1546 Protein (aa 1-157)

VAng-Lsx8116-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Clostridium Botulinum (strain Kyoto / Type A2) UPF0251 protein CLM_1546, recombinant protein.

Recombinant Chlamydophila Trachomatis ssb Protein (aa 1-157)

VAng-Lsx7278-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Chlamydophila Trachomatis (strain D/UW-3/Cx) Single-stranded DNA-binding protein, recombinant protein.

Recombinant Chlamydophila Trachomatis ssb Protein (aa 1-157)

VAng-Lsx7278-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Chlamydophila Trachomatis (strain D/UW-3/Cx) Single-stranded DNA-binding protein, recombinant protein.

Recombinant Chlamydophila Trachomatis ssb Protein (aa 1-157)

VAng-Lsx7278-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Chlamydophila Trachomatis (strain D/UW-3/Cx) Single-stranded DNA-binding protein, recombinant protein.

Recombinant Shigella Boydii sbmC Protein (aa 1-157)

VAng-Lsx09381-1mgEcoli 1 mg (E. coli)
EUR 3404.00
Description: Shigella Boydii serotype 18 (strain CDC 3083-94 / BS512) DNA gyrase inhibitor, recombinant protein.

Recombinant Shigella Boydii sbmC Protein (aa 1-157)

VAng-Lsx09381-500gEcoli 500 µg (E. coli)
EUR 2291.00
Description: Shigella Boydii serotype 18 (strain CDC 3083-94 / BS512) DNA gyrase inhibitor, recombinant protein.

Recombinant Shigella Boydii sbmC Protein (aa 1-157)

VAng-Lsx09381-50gEcoli 50 µg (E. coli)
EUR 1576.00
Description: Shigella Boydii serotype 18 (strain CDC 3083-94 / BS512) DNA gyrase inhibitor, recombinant protein.

Recombinant Brucella Abortus greA Protein (aa 1-157)

VAng-Lsx5165-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Brucella Abortus (strain S19) Transcription elongation factor GreA, recombinant protein.

Recombinant Brucella Abortus greA Protein (aa 1-157)

VAng-Lsx5165-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Brucella Abortus (strain S19) Transcription elongation factor GreA, recombinant protein.

Recombinant Brucella Abortus greA Protein (aa 1-157)

VAng-Lsx5165-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Brucella Abortus (strain S19) Transcription elongation factor GreA, recombinant protein.

Recombinant Bordetella Parapertussis BPP1139 Protein (aa 1-157)

VAng-Lsx4461-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Bordetella Parapertussis Probable rRNA maturation factor, recombinant protein.

Recombinant Bordetella Parapertussis BPP1139 Protein (aa 1-157)

VAng-Lsx4461-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Bordetella Parapertussis Probable rRNA maturation factor, recombinant protein.

Recombinant Bordetella Parapertussis BPP1139 Protein (aa 1-157)

VAng-Lsx4461-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Bordetella Parapertussis Probable rRNA maturation factor, recombinant protein.

Recombinant Helicobacter Pylori ruvC Protein (aa 1-157)

VAng-Lsx3390-inquire inquire Ask for price
Description: Helicobacter Pylori Crossover junction endodeoxyribonuclease RuvC, recombinant protein.

Recombinant Helicobacter Pylori coaD Protein (aa 1-157)

VAng-Lsx3497-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Helicobacter Pylori Phosphopantetheine adenylyltransferase, recombinant protein.

Recombinant Helicobacter Pylori coaD Protein (aa 1-157)

VAng-Lsx3497-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Helicobacter Pylori Phosphopantetheine adenylyltransferase, recombinant protein.

Recombinant Helicobacter Pylori coaD Protein (aa 1-157)

VAng-Lsx3497-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Helicobacter Pylori Phosphopantetheine adenylyltransferase, recombinant protein.

Recombinant Helicobacter Pylori rppH Protein (aa 1-157)

VAng-Lsx3520-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Helicobacter Pylori RNA pyrophosphohydrolase, recombinant protein.

Recombinant Helicobacter Pylori rppH Protein (aa 1-157)

VAng-Lsx3520-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Helicobacter Pylori RNA pyrophosphohydrolase, recombinant protein.

Recombinant Helicobacter Pylori rppH Protein (aa 1-157)

VAng-Lsx3520-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Helicobacter Pylori RNA pyrophosphohydrolase, recombinant protein.

Recombinant Brucella Abortus dut Protein (aa 1-157)

VAng-Lsx5123-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Brucella Abortus (strain S19) Deoxyuridine 5'-triphosphate nucleotidohydrolase, recombinant protein.

Recombinant Brucella Abortus dut Protein (aa 1-157)

VAng-Lsx5123-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Brucella Abortus (strain S19) Deoxyuridine 5'-triphosphate nucleotidohydrolase, recombinant protein.

Recombinant Brucella Abortus dut Protein (aa 1-157)

VAng-Lsx5123-50gEcoli 50 µg (E. coli)
EUR 1571.00
Description: Brucella Abortus (strain S19) Deoxyuridine 5'-triphosphate nucleotidohydrolase, recombinant protein.

Recombinant Brucella Abortus aroQ Protein (aa 1-157)

VAng-Lsx5138-1mgEcoli 1 mg (E. coli)
EUR 3396.00
Description: Brucella Abortus (strain S19) 3-dehydroquinate dehydratase, recombinant protein.

Recombinant Brucella Abortus aroQ Protein (aa 1-157)

VAng-Lsx5138-500gEcoli 500 µg (E. coli)
EUR 2296.00
Description: Brucella Abortus (strain S19) 3-dehydroquinate dehydratase, recombinant protein.

Phylogenetic analyses of the PKFAd18 penton gene showed higher homology with FAdV-9, highlighting potential natural recombination between FAdV-11 and FAdV-9. Moreover, the pathogenicity of PKFAd18 studied in specific-pathogen-free chickens showed that PKFAd18 is capable of inducing severe IBH and could be responsible for IBH in Pakistan.

Thus, the first complete genome of FAdV-11 in Pakistan was sequenced in this study, which enriches the diversity of knowledge about FAdV-11 and is useful for developing diagnostics and vaccines for IBH induced by FAdV-11 in Pakistan.